ID: 1176091666_1176091672

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1176091666 1176091672
Species Human (GRCh38) Human (GRCh38)
Location 20:63321085-63321107 20:63321101-63321123
Sequence CCTCAAGGACCCCCAGTGAGTCC TGAGTCCAGTGGCGTCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 160} {0: 1, 1: 0, 2: 2, 3: 36, 4: 1386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!