ID: 1176109914_1176109930

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1176109914 1176109930
Species Human (GRCh38) Human (GRCh38)
Location 20:63406502-63406524 20:63406550-63406572
Sequence CCCACATGGGCCCCTCCAGGGCC TGTAAGAAAAGGGCCCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 310} {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!