ID: 1176131645_1176131666

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1176131645 1176131666
Species Human (GRCh38) Human (GRCh38)
Location 20:63498966-63498988 20:63498999-63499021
Sequence CCGGCCACCCTCTGCCCCCCAGG GGGGTCCCTCTTCGGAAGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 142, 4: 1280} {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!