ID: 1176140780_1176140791

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1176140780 1176140791
Species Human (GRCh38) Human (GRCh38)
Location 20:63544162-63544184 20:63544186-63544208
Sequence CCACCCCAAGGTCAAGGGCCACT ACCTGGTGGGGGACAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 180} {0: 1, 1: 0, 2: 4, 3: 66, 4: 609}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!