ID: 1176144828_1176144843

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1176144828 1176144843
Species Human (GRCh38) Human (GRCh38)
Location 20:63560952-63560974 20:63560993-63561015
Sequence CCCTGACACCCCTAGACCCAGAG ACACCCGCGTCTGCACACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 185} {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!