ID: 1176169526_1176169537

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1176169526 1176169537
Species Human (GRCh38) Human (GRCh38)
Location 20:63690653-63690675 20:63690679-63690701
Sequence CCCGAGGCTGAGACTCCCCCCAA CAGGGAGGACACCCACAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 174} {0: 1, 1: 0, 2: 2, 3: 30, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!