ID: 1176172329_1176172338

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1176172329 1176172338
Species Human (GRCh38) Human (GRCh38)
Location 20:63701612-63701634 20:63701637-63701659
Sequence CCTGCCCTGAGGTGGGAGAACCT AGGGCTGGCAGCAGCAGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 218} {0: 1, 1: 0, 2: 4, 3: 72, 4: 575}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!