ID: 1176177306_1176177310

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1176177306 1176177310
Species Human (GRCh38) Human (GRCh38)
Location 20:63734879-63734901 20:63734895-63734917
Sequence CCAGCAGCCATCAGGTTCCCGGG TCCCGGGGTCCCGCAGCCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 154} {0: 1, 1: 0, 2: 0, 3: 5, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!