ID: 1176178387_1176178393

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1176178387 1176178393
Species Human (GRCh38) Human (GRCh38)
Location 20:63739021-63739043 20:63739043-63739065
Sequence CCTGGCCGCTCTGACAGCCGCGG GCCTCCCCGGGCTCCAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127} {0: 1, 1: 0, 2: 0, 3: 22, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!