ID: 1176178789_1176178802

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1176178789 1176178802
Species Human (GRCh38) Human (GRCh38)
Location 20:63740217-63740239 20:63740256-63740278
Sequence CCGCGCCGGGCTGGGGGCGGGGC CCGTCCACACCGGCCGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 102, 4: 737} {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!