ID: 1176215203_1176215207

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1176215203 1176215207
Species Human (GRCh38) Human (GRCh38)
Location 20:63944637-63944659 20:63944650-63944672
Sequence CCCTCGATGTCCCGGCCGCGCTC GGCCGCGCTCACTGATGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39} {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!