ID: 1176241193_1176241200

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1176241193 1176241200
Species Human (GRCh38) Human (GRCh38)
Location 20:64076710-64076732 20:64076734-64076756
Sequence CCACCTTCCCATGGGTAGCCCTG TCCCAGGCACATGACCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 257} {0: 2, 1: 0, 2: 1, 3: 9, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!