ID: 1176248169_1176248174

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1176248169 1176248174
Species Human (GRCh38) Human (GRCh38)
Location 20:64107251-64107273 20:64107265-64107287
Sequence CCCTTGAATCTGAAGGTCCTTCC GGTCCTTCCCTCAGGGGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161} {0: 1, 1: 0, 2: 4, 3: 32, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!