ID: 1176384687_1176384698

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1176384687 1176384698
Species Human (GRCh38) Human (GRCh38)
Location 21:6133485-6133507 21:6133534-6133556
Sequence CCAAGCCTGCACCGGAGCCAGCC CACGCGTGACGTCTGGCACCTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 2, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!