ID: 1176468346_1176468351

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1176468346 1176468351
Species Human (GRCh38) Human (GRCh38)
Location 21:7080225-7080247 21:7080247-7080269
Sequence CCTGCAGGGCAGACACCCAGGAA ATAATCAACTGGGCCTTCAGTGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 5, 3: 47, 4: 383} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!