ID: 1176837211_1176837216

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1176837211 1176837216
Species Human (GRCh38) Human (GRCh38)
Location 21:13804307-13804329 21:13804341-13804363
Sequence CCACCAGTTTTCAGGAGAGATCC AATTAAGCTAAACACGGCAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!