ID: 1176869692_1176869704

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1176869692 1176869704
Species Human (GRCh38) Human (GRCh38)
Location 21:14074994-14075016 21:14075040-14075062
Sequence CCCATCCAAGGACCTCTTCAGGA CTGTTGTAGCAGAGGGCATGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!