ID: 1176937270_1176937278

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1176937270 1176937278
Species Human (GRCh38) Human (GRCh38)
Location 21:14881960-14881982 21:14882000-14882022
Sequence CCATGGATCATACCTTCTCTCTG AGGGCCAAGGGATCTCTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 221} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!