ID: 1177788220_1177788228

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1177788220 1177788228
Species Human (GRCh38) Human (GRCh38)
Location 21:25695450-25695472 21:25695486-25695508
Sequence CCGCCATCGTCATCATGGCCCGT TTGGGTACACCTCCCAGACGGGG
Strand - +
Off-target summary {0: 363, 1: 891, 2: 815, 3: 196, 4: 115} {0: 920, 1: 956, 2: 411, 3: 80, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!