ID: 1177893679_1177893686

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1177893679 1177893686
Species Human (GRCh38) Human (GRCh38)
Location 21:26836760-26836782 21:26836787-26836809
Sequence CCATATTCCCAAAGCAGGGTTAC TAGGAAAGAAAGGAAGTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 105} {0: 1, 1: 0, 2: 5, 3: 97, 4: 850}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!