ID: 1178140105_1178140112

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1178140105 1178140112
Species Human (GRCh38) Human (GRCh38)
Location 21:29673039-29673061 21:29673078-29673100
Sequence CCTTGCCTTTCTTCATCTCCTTG CTTTATTCCCAGAGGGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 93, 4: 790} {0: 1, 1: 0, 2: 1, 3: 18, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!