ID: 1178535550_1178535552

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1178535550 1178535552
Species Human (GRCh38) Human (GRCh38)
Location 21:33407454-33407476 21:33407489-33407511
Sequence CCAAGTGCTTTATATACATTACC CTCAGCCATTCTTTCGAACTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!