ID: 1178552491_1178552498

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1178552491 1178552498
Species Human (GRCh38) Human (GRCh38)
Location 21:33552459-33552481 21:33552512-33552534
Sequence CCCAATGGCTGATCGATCTATGA CGTCATACTCTGCTGCTGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 50} {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!