ID: 1178696379_1178696392

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1178696379 1178696392
Species Human (GRCh38) Human (GRCh38)
Location 21:34796427-34796449 21:34796473-34796495
Sequence CCATCCAGCTGTAGCTCTTCTGT CTGATTCAGCAGAAGTGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 229} {0: 1, 1: 0, 2: 3, 3: 46, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!