ID: 1178700300_1178700307

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1178700300 1178700307
Species Human (GRCh38) Human (GRCh38)
Location 21:34827702-34827724 21:34827733-34827755
Sequence CCCCAGCTGTGGCTTCAGTGGGC ACCTAGGCTGCCATTCTGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!