ID: 1178734968_1178734975

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1178734968 1178734975
Species Human (GRCh38) Human (GRCh38)
Location 21:35141003-35141025 21:35141045-35141067
Sequence CCTTAGCTGTGTGATCTTGTACT GGCTGGGATTATGCAAAATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!