ID: 1178737448_1178737452

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1178737448 1178737452
Species Human (GRCh38) Human (GRCh38)
Location 21:35165876-35165898 21:35165903-35165925
Sequence CCTTGAGGAGAAAACACCTGGGA CTGGCTTGCAACTCCTACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 276} {0: 1, 1: 0, 2: 2, 3: 11, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!