ID: 1178749219_1178749223

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1178749219 1178749223
Species Human (GRCh38) Human (GRCh38)
Location 21:35284498-35284520 21:35284515-35284537
Sequence CCCACCTCAGGGTCTTTGCCCTG GCCCTGCAGTGCCCTTGGACTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 66, 3: 349, 4: 1245} {0: 1, 1: 0, 2: 3, 3: 17, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!