ID: 1178762087_1178762092

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1178762087 1178762092
Species Human (GRCh38) Human (GRCh38)
Location 21:35412699-35412721 21:35412736-35412758
Sequence CCCACTCAGAAAGCAGAAGAAAG GAGCAGATCCTCTGTGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 547} {0: 1, 1: 1, 2: 2, 3: 16, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!