ID: 1178765947_1178765957

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1178765947 1178765957
Species Human (GRCh38) Human (GRCh38)
Location 21:35450995-35451017 21:35451042-35451064
Sequence CCATTCGCGTCTCAGGCTTGGCC GCCTCTGGACCTGTAGTGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 112, 3: 704, 4: 1278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!