ID: 1178794149_1178794155

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1178794149 1178794155
Species Human (GRCh38) Human (GRCh38)
Location 21:35728106-35728128 21:35728134-35728156
Sequence CCTTCCACCTCCTCCATCTCTGC CTGCCCCTCTTGAGACAGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 38, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!