ID: 1178918464_1178918471

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1178918464 1178918471
Species Human (GRCh38) Human (GRCh38)
Location 21:36722789-36722811 21:36722833-36722855
Sequence CCATCAGGGGCCTCAGGGGTGGC AGAGCCAAGGAAGCCACACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!