ID: 1178922976_1178922988

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1178922976 1178922988
Species Human (GRCh38) Human (GRCh38)
Location 21:36751500-36751522 21:36751549-36751571
Sequence CCTTGGGGGACCCCCAGAGGCTG CTGTGCACCCGCACCCCAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 298} {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!