ID: 1178970046_1178970050

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1178970046 1178970050
Species Human (GRCh38) Human (GRCh38)
Location 21:37166232-37166254 21:37166249-37166271
Sequence CCAGGTTTGCCCCAGTACACCAG CACCAGCATATATACACCCTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 116} {0: 2, 1: 0, 2: 0, 3: 8, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!