ID: 1179209497_1179209513

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1179209497 1179209513
Species Human (GRCh38) Human (GRCh38)
Location 21:39313392-39313414 21:39313443-39313465
Sequence CCGAAGCAGCCGGGAGCGCCAGG CCGACTCGATGAGAGGCACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 172} {0: 1, 1: 0, 2: 1, 3: 2, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!