ID: 1179486273_1179486283

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1179486273 1179486283
Species Human (GRCh38) Human (GRCh38)
Location 21:41712593-41712615 21:41712612-41712634
Sequence CCCACCTCCCTTTGTCTCTCCAG CCAGCCAGAGGTGGGCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 625} {0: 1, 1: 0, 2: 4, 3: 35, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!