ID: 1179647408_1179647419

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1179647408 1179647419
Species Human (GRCh38) Human (GRCh38)
Location 21:42784332-42784354 21:42784378-42784400
Sequence CCCGAAAGGACCCGAGGTGATAC AGCCTCCCCCGCTTCAGGTCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!