ID: 1179741847_1179741852

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1179741847 1179741852
Species Human (GRCh38) Human (GRCh38)
Location 21:43421494-43421516 21:43421518-43421540
Sequence CCGGGGCCTCCGTGCCTGCCAGC TGATGTCCCTGCTCCCACCCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 10, 3: 44, 4: 480} {0: 4, 1: 0, 2: 4, 3: 35, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!