ID: 1179847789_1179847797

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1179847789 1179847797
Species Human (GRCh38) Human (GRCh38)
Location 21:44120818-44120840 21:44120848-44120870
Sequence CCCTCCTGTCTCCTGGGAGAGGA GAGCTGAGGTTACACTCCGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 35, 4: 352} {0: 2, 1: 0, 2: 1, 3: 5, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!