ID: 1179881103_1179881112

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1179881103 1179881112
Species Human (GRCh38) Human (GRCh38)
Location 21:44293678-44293700 21:44293698-44293720
Sequence CCCGCCGTCCAGCCCTGGGTGGT GGTCCCAGGGGAGAGCGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172} {0: 1, 1: 0, 2: 3, 3: 14, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!