ID: 1179913333_1179913351

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1179913333 1179913351
Species Human (GRCh38) Human (GRCh38)
Location 21:44461385-44461407 21:44461434-44461456
Sequence CCCCCGGCCTCCTCTGCAGGGGC ACCTCCCGCCACAGAGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 388} {0: 1, 1: 0, 2: 3, 3: 18, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!