ID: 1179976832_1179976843

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1179976832 1179976843
Species Human (GRCh38) Human (GRCh38)
Location 21:44873291-44873313 21:44873318-44873340
Sequence CCCCTGCCCGCGCCCCAGCCGCG CAGCTCCCGCGGCCGCCAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 83, 4: 811} {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!