ID: 1179987962_1179987978

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1179987962 1179987978
Species Human (GRCh38) Human (GRCh38)
Location 21:44931819-44931841 21:44931862-44931884
Sequence CCTGGCCCCGGGCTTCAGGAAAA TCTCCCTAGCGGAGGCTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 215} {0: 1, 1: 0, 2: 0, 3: 11, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!