ID: 1179995724_1179995730

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1179995724 1179995730
Species Human (GRCh38) Human (GRCh38)
Location 21:44973280-44973302 21:44973313-44973335
Sequence CCACCTCCTCAGGGGTTCAGCTC TCACCCTGCCCACCCTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 394} {0: 1, 1: 6, 2: 4, 3: 67, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!