ID: 1180014081_1180014085

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1180014081 1180014085
Species Human (GRCh38) Human (GRCh38)
Location 21:45071737-45071759 21:45071777-45071799
Sequence CCAGCATCAGGTTTATTTTCCAG TTATTCCATAATTCCCACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 220} {0: 1, 1: 0, 2: 3, 3: 12, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!