ID: 1180014841_1180014854 |
View in Genome Browser |
Spacer: 26 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1180014841 | 1180014854 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 21:45075054-45075076 | 21:45075103-45075125 |
Sequence | CCGAGTCCGCGTGGGATGCGCCG | GCCGGGACGAGGCTGCGCCCTGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |