ID: 1180079102_1180079113

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1180079102 1180079113
Species Human (GRCh38) Human (GRCh38)
Location 21:45478162-45478184 21:45478193-45478215
Sequence CCCTTGTGGGTGTGAGGAGGCTC GGTGCGAGGACATCGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 164} {0: 1, 1: 0, 2: 1, 3: 8, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!