ID: 1180083032_1180083044

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1180083032 1180083044
Species Human (GRCh38) Human (GRCh38)
Location 21:45495170-45495192 21:45495196-45495218
Sequence CCTCCTCCCAAAAGGGTCCTTGT GGAAAGGGGTGAGAAGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 189} {0: 1, 1: 1, 2: 2, 3: 86, 4: 786}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!