ID: 1180155371_1180155385

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1180155371 1180155385
Species Human (GRCh38) Human (GRCh38)
Location 21:45974821-45974843 21:45974874-45974896
Sequence CCACCACCGCGGAAACCGCATGT GAGTCATGTTCTAAGTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28} {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!