ID: 1180177609_1180177614

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1180177609 1180177614
Species Human (GRCh38) Human (GRCh38)
Location 21:46098132-46098154 21:46098146-46098168
Sequence CCGCGCCTCGGGCCGTCGGGAGC GTCGGGAGCGGAGCCTCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 104} {0: 1, 1: 0, 2: 0, 3: 12, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!